PIB Analysis for UPSC CSE
Topics Covered
- Indian Pharmacopoeia (IP)
- EChO Network
- European Council
- Nagpur Resolution
- Quick Reaction Surface to Air Missile
- Environment Education Awareness and Training (EEAT)
- DNA Profiling
- Facts for Prelims : Singareni Collieries Company Limited, ICF
1 . Indian Pharmacopoeia (IP)
About Indian Pharmacopoeia
- Indian Pharmacopoeia (IP) is published by the Indian Pharmacopoeia Commission (IPC) on behalf of the Ministry of Health & Family Welfare, Government of India in fulfillment of the requirements of the Drugs and Cosmetics Act, 1940 and Rules 1945 thereunder.
- IP is recognized as the official book of standards for the drugs being manufactured and/or marketed in India.
- IP contains a collection of authoritative procedures of analysis and specifications of drugs for their identity, purity and strength.
- The standards of the IP are authoritative in nature and are enforced by the regulatory authorities for ensuring the quality of drugs in India. During quality assurance and at the time of dispute in the court of law the IP standards are legally acceptable.
Importance
- The quality, efficacy and safety of the medicines are important from healthcare perspective.
- In order to ensure the quality of medicinal products, the legal and scientific standards are provided by Indian Pharmacopoeia Commission (IPC) in the form of Indian Pharmacopoeia (IP).
- As per, the Second Schedule of the Drugs and Cosmetics Act, IP is designated as the official book of standards for drugs imported and/or manufactured for sale, stock or exhibition for sale or distribution in India.
- The IP Commission’s mission is to promote public and animal health in India by bringing out authoritative and officially accepted standards for quality of drugs including active pharmaceutical ingredients, excipients and dosage forms, used by health professionals, patients and consumers.
- This is achieved by developing the standards for medicines and supporting their implementation.
- In addition, IPC also develops IP Reference Substances (IPRS) that act as fingerprint for identification of an article under test and its purity as prescribed in the IP monographs. Standards prescribed in the IP are authoritative in nature and are enforced by the regulatory authorities for quality control of medicines in India.
About the News
- The Indian Pharmacopoeia (IP) has been recognised formally by the National Department of Regulation of Medicines and Health Products of the Ministry of Public Health of Islamic Republic of Afghanistan.
- It will also be used based on the requirement as reputable pharmacopoeia in the laboratory of medicines and health products quality. With this, a new beginning has been made and Afghanistan has become the first country to recognize IP pursuant to the efforts of Department of Commerce and Ministry of Health and Family Welfare.
2 . EChO Network
Context : EChO Network, a national program to provide a template for cross-disciplinary leadership in India with the specific focus of increasing research, knowledge, and awareness of Indian ecology and the environment was launched
Background
- India has recently embarked on a number of national-level efforts to promote ecological and environmental research on the subcontinent; however, there remains a lacuna of trained scientists with interdisciplinary skills and collaborative mindset.
- We need to train a new generation of educators and students who can identify and solve problems in an interdisciplinary manner and who can listen to our natural world and tackle real-world problems in medicine, agriculture, ecology, and technology
About EChO Network
- EChO Network would develop a national network to catalyse a new generation of Indians who can synthesize interdisciplinary concepts and tackle real-world problems in medicine, agriculture, ecology, and technology.
- With no precedent for such a network anywhere in the world, EChO Network establishes a new platform to change how science is embedded in our modern society.
- Through interactive sessions with citizens, industry, academia, and the government, the Network will identify gaps in knowledge regarding selected topics in human and environmental ecosystems.
- The program will then train postdoctoral leaders in research and outreach on these topics, while also incorporating current public and private efforts into a national network.
- It would then go on to establishing nation-wide awareness in these issues through public discourse and education for citizens, industry, and government with information exchange at all educational levels.
- Over time EChO Network intends to create an international distributed institute comprising individuals housed within industry, government, private, and academic sectors, combining their expertise and resources collectively to tackle large scale problems.
- The initiative has drawn in partners from Government, industry and academia, with the Office of the Principal Scientific Adviser to the Govt. of India steering the program under the guidance of Prof. Shannon Olsson, Director, EChO Network. Bill and Melinda Gates Foundation, Hindustan Unilever Limited, RoundGlass, India Climate Collaborative, Ashoka Trust for Research in Ecology and the Environment (ATREE), and Centre for Cellular and Molecular Platforms (C-CAMP) are the founding partners of the EChO Network.
Goal of EChO Network
- The purpose of the Network is to bring all those together to share knowledge and synergize efforts under the umbrella of science. In order to do this leaders are required who are trained to communicate across different sectors of society, this is the goal of the EChO Network
3 . European Council
About European Council
- The European Council brings together EU leaders to set the EU’s political agenda. It represents the highest level of political cooperation between EU countries.
- One of the EU’s 7 official institutions, the Council takes the form of (usually quarterly) summit meetings between EU leaders, chaired by a permanent president.
What does the European Council do?
- Decides on the EU’s overall direction and political priorities – but does not pass laws.
- Deals with complex or sensitive issues that cannot be resolved at lower levels of intergovernmental cooperation
- Sets the EU’s common foreign & security policy, taking into account EU strategic interests and defence implications
- Nominates and appoints candidates to certain high profile EU level roles, such as the ECB and the Commission
On each issue, the European Council can:
- ask the European Commission to make a proposal to address it.
- pass it on to the Council of the EU to deal with
Composition
- The European Council is made up of the heads of state or government of all EU countries, the European Council President, and the European Commission President.
- It is convened and chaired by its President, who is elected by the European Council itself for a once-renewable two-and-a-half-year term. The President represents the EU to the outside world.
How does the European Council work?
- It usually meets 4 times a year – but the President can convene additional meetings to address urgent issues.
- It generally decides issues by consensus – but by unanimity or qualified majority in some cases. Only the heads of state/government can vote.
4 . Nagpur Resolution
Context : The ‘Nagpur Resolution- A holistic approach for empowering citizens’ was adopted during the Valedictory session of the two-day Regional Conference on ‘Improving Public Service Delivery – Role of Governments’, in Nagpur, Maharashtra
Nagpur Resolution: A Holistic approach for empowering citizens’
The Conference unanimously adopted the ‘Nagpur Resolution: A Holistic Approach for Empowering Citizens’ outlined below after intensive deliberations during the sessions held over two days.
The Conference resolved that Government of India, the Government of Maharashtra, the Maharashtra State Commission for Right to Public Services and the participating State Governments shall collaborate to:
- To empower the citizens by policy interventions for better service delivery through timely updation of citizens charters, implementation of enactments and benchmarking standards for continuous improvement;
- To empower citizens by adopting a bottom-up approach to bring massive improvements in quality of grievance redressal and reduction in timelines of grievance redressal;
- To adopt a holistic approach of systemic public grievance reforms through improved mapping, formulation of monitoring matrix, data collection and evaluation in quality of grievance redressal;
- To provide an enabling environment for States and Ministries/ Departments of the Government of India for creating web portals and to adopt a holistic approach for improved service delivery through digital platforms;
- To focus on dynamic policy making and strategic decisions, monitoring of implementation, appointment of key personnel, coordination and evaluation;
- To achieve a sense of common identity by exchange of technical expertise in the areas of Improved Service Delivery between the paired States under the Ek Bharat – Shresht Bharat Program;
- To work towards long-term engagements in the areas of Improved Service Delivery for Empowering Citizens through greater cooperation between the DARPG and the participating States and,
- To ensure timely publication of Good Governance Index to identify the quality of governance in 10 sectors especially those pertaining to welfare and infrastructure at the Union, State and District levels.
5 . Quick Reaction Surface to Air Missile
Context : Quick Reaction Surface to Air Missile (QRSAM) system developed by Defence Research and Development Organisation (DRDO) was successfully flight-tested from Integrated Test Range, Chandipur off the Odisha coast at 1145 hrs today.
Details of the Mission
- The missile was flight-tested with full configuration in deployment mode intercepting the target mid-air, meeting the mission objectives.
- The entire event was monitored by Ground Telemetry Systems, Range Radar Systems, Electro Optical Tracking System etc.
About Quick Reaction Surface to Air Missile
- The QRSAM weapon system operates on the move, comprises of fully automated Command and Control System, Active Array Battery Surveillance Radar, Active Array Battery Multifunction Radar and Launcher. Both radars are four-walled having 360-degree coverage with search on move and track on move capability.
- The system is compact with minimum number of vehicles for a firing unit.
- Single stage solid propelled missile has mid course inertial navigation system with two-way data link and terminal active seeker developed indigenously by DRDO.
- The missile successfully engaged the aerial target establishing its capability. Director General (Missiles and Strategic Systems) Shri MSR Prasad was present during the trial.
- With this mission, the developmental trials of the weapon system are successfully completed and the weapon system is expected to be ready for induction by 2021.
6 . Environment Education Awareness & Training Scheme (EEAT)
Environment Education Awareness Scheme
- Environment Education Awareness and Training (EEAT) is an established central sector scheme of the Ministry continuing since 1983-84 and aims to promote environmental awareness and mobilize student’s participation for environment conservation.
- Under the scheme, National Green Corps (NGC) ‘Ecoclub’ programme was initiated in 2001-2002 with the objective to impart knowledge to school children through hands on experience, about their immediate environment, interactions within it and the problems therein.
- The programme aims to inculcate proper attitude towards environment and sensitize children on issues related to environment and development.
7 . DNA Profiling
Context : Minister of State for Home Affairs, Shri Nityanand Rai, today inaugurated a State-of-the-Art DNA Analysis Centre at CFSL, Chandigarh.
About the Lab
- Advanced Forensic DNA Analysis Lab has been set up under the Nirbhaya Fund scheme
- This Centre will provide State-of-the-art facility for (i) Sexual Assault and Homicide Unit (ii) Paternity Unit (iii) Human Identification Unit and (iv) Mitochondrial DNA Unit. DFSS has ensured that this Centre is fully equipped with modern DNA Profiling tools and equipment. This Advanced Forensic DNA Analysis facility has a capacity of examining 2000 cases
- Forensic DNA Profiling is a very sensitive and reproducible technique that has become one of the most valuable tools in modern criminal investigation such as human identification in mass disasters, paternity and maternity disputes, identification of victim and suspect in rape and murder cases, child swapping in hospitals, identification of deceased, organ transplantation and immigration.
About DNA Profiling
- DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from a person or sample of bodily tissue
- Even though we are all unique, most of our DNA is actually identical to other people’s DNA. However, specific regions vary highly between people. These regions are called polymorphic. Differences in these variable regions between people are known as polymorphisms. Each of us inherits a unique combination of polymorphisms from our parents. DNA polymorphisms can be analysed to give a DNA profile.
- Human DNA profiles can be used to identify the origin of a DNA sample at a crime scene or test for parentage.
- DNA profiling is used to:
- identify the probable origin of a body fluid sample associated with a crime or crime scene
- reveal family relationships
- identify disaster victims, for example, ESR scientists travelled to Thailand to help identify victims of the 2004 Boxing Day tsunami.
What are short tandem repeats?
- One of the current techniques for DNA profiling uses polymorphisms called short tandem repeats.
- Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence.
- For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times.
- STRs are found at different places or genetic loci in a person’s DNA.
What is a DNA profile?
- One way to produce a DNA profile, is for scientists to examineSTRs at 10 or more genetic loci. These genetic loci are usually on different chromosomes.
- A DNA profile can tell the scientist if the DNA is from a man or woman, and if the sample being tested belongs to a particular person.
8 . Facts for Prelims
DigiSky
DigiSky online portal has been launched for flying Civil Drones. The Beta version of DigiSky is available and captures the entire gamut of activities relating to drones viz. registration of drones and pilots, approval of flight path, post flight analysis etc. based on the distinctive features of No Permission No Take off (NPNT).
E-sahaj
100% security clearances pertaining to the Ministry have been made online on E-sahaj online portal launched by the Ministry of Civil Aviation. The portal is operational for granting clearances in respect of 24 categories.
DigiYatra
Trial for rollout of DigiYatra has been started at Bengaluru and Hyderabad airports. It envisages seamless and hassle free passenger travel using biometric technologies to improve passenger experience, reduce queue waiting time as passengers can walk through e-gates. It will remove redundancies at check points and enhance resource utilization.
Air Sewa
An initiative by MoCA to bring all aviation stakeholders to a common platform so as to address the grievances of the air travellers. The status of the issues raised can be tracked online. The platform also provides updated flight status and is linked to social media.
ODF + and ODF ++
- MoHUA has launched the ODF+ and ODF++ protocols, with a focus on sustaining ODF outcomes and achieving holistic sanitation. While ODF+ protocol focuses on O&M of community / public toilets by ensuring functionality and proper maintenance of CT/PTs for their continued usage
- ODF++ focuses on addressing safe management of faecal sludge from toilets and ensuring that no untreated sludge is discharged into open drains, water bodies or in the open.
- Till date,819 cities have been certified ODF+, and 312 cities have been certified ODF++.
- Recently, MoHUA has introduced the Water + protocol, designed to ensure that no untreated waste water is discharged into the open environment or water bodies.